יום ראשון, 20 בפברואר 2011

פוסט רציני שני

הפוסט הזה הולך להיות די ארוך, וזה למרות שהשבוע די מנומנם מבחינת חדשות בריאות. אם לא בא לכם לקרוא הכל, הטקסטים המודגשים מסבירים את הנושא של כל חלק בפוסט, כך שאפשר לדלג על מה שנראה לכם משעמם או ארוך מדי.

כאמור, לא קרה הרבה השבוע מבחינת מחקר רפואי פורץ דרך, לכן הפוסט הזה יורכב בעיקר מתשובות לשאלות שעלו בתגובות לפוסט הקודם. התגובות נמצאות עדיין בתפוז, אין לי דרך להעביר אותן לכאן, ולכן אעשה עבורכם את העבודה השחורה ואעתיק את השאלות לכאן.


אבל קודם כל, קצת חדשות רפואיות. האם חשוב לבצע מתיחות לפני ריצה? מסתבר שלא ממש. במחקר שלפנינו, חילקו קבוצה של 2729 אנשים משועממים שנוהגים לבלות את זמנם הפנוי בריצה, במקום בפעילויות שאני ממליצה עליהן לשעות הפנאי: אכילה או שינה. הקיצר, חילקו את האצנים לשתי קבוצות, אחת הונחתה לבצע מתיחות של 3-5 דקות לפני הריצה, והשניה – לא לבצע מתיחות. המחקר נמשך שלושה חודשים, וכמחצית מהנבדקים התמידו בניסוי עד הסוף. 600 בקבוצת הנמתחים, ו-798 בקבוצת הלא-נמתחים. מספר לא רע של נבדקים סכ”ה.

המסקנה – בשתי הקבוצות שיעור הפציעות במהלך שלושת החודשים היה 16%, אותו אחוז בין אם ביצעו מתיחות לפני הריצה ובין אם לאו. אבל, ממצא חשוב לא פחות הוא שהאנשים ששינו את הרגלי המתיחות שלהם (כלומר לפני המחקר היו רגילים לבצע מתיחות, ובמחקר הוקצו לקבוצת הלא-נמתחים, ולהיפך – אנשים שלא נהגו להימתח והוקצו לקבוצת הנמתחים), נטו להיפצע בשיעור של 22-23%, משמעותית יותר מאנשים שהמשיכו באותם הרגלי מתיחות שהיו מבצעים לפני המחקר. מסקנה סופית – תמשיכו במה שאתם רגילים לעשות. אם אתם רגילים להימתח, תמשיכו להימתח. אם אתם רגילים לא להימתח, תמשיכו לא להימתח.  

מקור:

http://www.webmd.com/fitness-exercise/news/20110217/stretch-before-running-new-twist-on-old-debate


וכעת, לשאלות הקוראים הנאמנים.

הקורא הנאמן antreprize שאל לגבי הסיפור של האוטיזם בגברים לעומת נשים, כיצד בודדו תאי מוח אנושיים בשביל המחקר? ובכן, שאלה טובה. קצת קשה לבודד תאי מוח מאנשים חיים, רובם צועקים ומרביצים ממש חזק בשלב שמנסרים להם את הגולגולת. מה שעשו במחקר הנ”ל הוא להשתמש בתאים שבודדו בשנת 1970 מביופסיה שנלקחה מגידול במוח של ילדה בת 4. אם לדייק, הביופסיה נלקחה מגרורה של הגידול, שהגיעה למח העצם של הילדה.

בגדול, כשרוצים לבודד תאים מרקמה אנושית צריך להוציא את הרקמה מהגוף, לשטוף אותה בתמיסה שמכילה אנזימים שמפרקים את הקשרים בין התאים שברקמה, ואז התאים מתפוררים ונפרדים. מגדלים את התאים בתוך צלוחית באינקובטור, בתוך תמיסה שמכילה את כל האוכל, הויטמינים וההורמונים שהתאים צריכים. התאים האהבלים נדבקים לתחתית הצלוחית, וחושבים שהם שוב חלק מרקמה. תאים מרקמה אנושית יכולים להחזיק מעמד כך בחיים במשך מספר ימים.

אם רוצים לשמור אותם יותר זמן, מעבירים אותם תהליך שביולוגים אוהבים לקרוא לו “אימורטליזציה”, מלשון immortal (חיי נצח). בתהליך הזה מכריחים את התאים לבטא גנים סרטניים, שגורמים לתאים להיות מסוגלים לחיות לנצח. זה מה שעשו עם התאים שנלקחו מגידול המוח של הילדה ההיא ב-1970, ומאז התאים הללו חיים ומשמשים להמון מחקרים נוירולוגיים בהמון מעבדות ברחבי העולם. אפילו לי יצא לעבוד איתם.


הקורא הנאמן שלומי (הידוע גם בשם “אבא שלי”) שאל למה אני מתכוונת כשאני כותבת “ביטוי של גנים”? ובכן, גם זו שאלה טובה. עם הסבר ארוך ומסובך, שאנסה לפשט לכמה משפטים. בגרעין של כל אחד מהתאים בגופנו ישנו דנ”א, את זה אתם בטח יודעים. הדנ”א מורכב מרצף ארוך מאוד של מולקולות מארבעה סוגים – אדנין, תימין, גואנין וציטוזין, שנקראים בקיצור  A, T, G, C. דנ”א אנושי מורכב מכשלושה מיליארד מולקולות כאלה. חלקים מהרצפים האלו נקראים גנים, והרצף שלהם הוא למעשה קוד בעל משמעות, שמוביל ליצירה של חלבון. כל הגוף שלנו בנוי מחלבונים ונשען על תפקודם, ולכן הקוד ליצירתם הוא חשוב מאוד. לדוגמא, הרצף בדנ”א: GAATTCGAGGCTGCAGTGCCCCCAGATCATACTACTGCACTCCAGCCTGGGTGATAAAGT

הוא 60 המולקולות הראשונות מתוך 7800, שמקודדות לחלבון הקולגן, שהוא החלבון הנפוץ ביותר בגוף האדם ומרכיב עיקרי בעור, בגידים, בעצמות, סחוס, ועוד.

הדנ”א בכל התאים בגוף זהה, וכל הגנים נמצאים בכל תא בגוף. אבל לא כל גן מתבטא בכל סוג של תא. כשאני כותבת מתבטא, הכוונה שהגוף יודע לקחת את הרצף בדנ”א שמקודד לחלבון מסויים (כלומר גן), ולהפוך אותו לחלבון בשר ודם. הבקרה על איזה גנים יתבטאו מתי, כמה, ואיפה, ויהפכו לחלבונים, היא ענף שלם של מחקר ביולוגי, שאי אפשר להסביר אותו על בפחות מקורס אוניברסיטאי רציני.

האיור הבא (שנלקח מהערך “חלבון” בויקיפדיה) מתאר את התהליך של יצירת חלבון מתוך הקוד שבדנ”א:

 

הדנ”א יושב סטטי בגרעין התא, והוא לא משתנה. חלבונים מסויימים יודעים לזהות היכן בדנ”א נמצאים הגנים, והם “מתיישבים” על הדנ”א ומשעתקים רק את הגנים, למולקולות זמניות שנקראות רנ”א. הרנ”א הזה מסוגל לעזוב את גרעין התא ולנדוד לחלל התא, שם חלבונים אחרים יודעים לקרוא את רצף הרנ”א (שזהה למעשה לרצף הדנ”א פרט לשינויים מבניים קלים) ולתרגם את הרצף לחלבון.

הסבר מפורט יותר (הרבה, הרבה יותר) עדיין בשפה פשוטה ומעניינת ניתן למצוא בבלוג של רועי צזנה. פוסט מספר 1, ופוסט מספר 2.


קיבלתי גם בקשות לכתיבת פוסטים ספציפיים, למשל בנושא מחלות נפש מגניבות. אבל אני אינני רופאה אלא מדענית בעלת ידע מסויים ברפואה, ומעדיפה להתמקד במחקרים מדעיים שקשורים לרפואה. קטונתי מלכתוב ישירות על מחלות, מה גם שיש אנשים שעושים זאת הרבה יותר טוב ממני. למשל בבלוג “סוף העולם - מבט מהיציע” בדיוק התפרסם פוסט על מחלת ספגת המוח, הידועה יותר בכינוי “הפרה המשוגעת”.


עוד בקשה ספציפית שקיבלתי היתה לכתוב על הנושא של הסרת שיער. עוד יותר ספציפית, האם הריון יכול לגרום לשיער שהוסר באחת משיטות הלייזר למיניהן לחזור ולצמוח? ועד כמה קריטי שרופא/ה יבצע את הסרת השיער ולא קוסמטיקאי/ת?

אז התשובה לשאלה הראשונה היא שכן, שינויים הורמונליים בהריון עלולים לגרום לשיער באזור שעבר לייזר לחזור ולצמוח. אם הוא חזר וצמח אחרי טיפול בלייזר, הוא עלול להישאר שם גם אחרי ההריון. אבל הסבירות היא נמוכה. תעשו את השיקולים שלכן. אבל שימו לב בנות, הסרת שיער במכשירי הלייזר למיניהם לוקחת כשנתיים, כי יש צורך בסדרה של כמה טיפולים עם כשלושה חודשים הפרש בין הטיפולים. במשך השנתיים האלו רצוי לא להיכנס להריון, גם כי לא הוכח עדיין שהסרת שיער בזמן הריון היא בטוחה (אם כי סביר להניח שהיא בטוחה), וגם כי במשך כל התקופה של הטיפולים אסור להסיר שיער בשום צורה אחרת פרט לגילוח. ואני רוצה לראות בחורה בחודש שישי ומעלה מתכופפת במקלחת לגלח את הרגליים.

לגבי השאלה השניה, אם מדובר בלייזר ממש, הכי בטוח שמי שמבצע את הטיפול יהיה רופא/ה, ואם זה רופא עור או פלסטיקאי אז בכלל סבבה. אני לא אומרת שחובה מוחלטת שזה יהיה רופא/ה, בכל זאת ברוב המקרים אין בעיות ובמצב של אין בעיות גם קוסמטיקאי/ת יכול לתפקד היטב. שוב, תעשו את השיקולים שלכם. לכל שאר השיטות (אינפרה אדום וכו’) שהן פחות “אלימות” (ובהתאמה גם פחות יעילות), אפשר קוסמטיקאי/ת, אבל בכל מקרה חשוב שרופא/ת עור או פלסטיקאי/ת  שמנוסים בעניין יראו אתכם קודם וימליצו על השיטה להסרת שיער המומלצת, כי יש המון שיטות שמתאימות לכל מיני סוגי שיער וצבעי עור, ואי אפשר לתת המלצה ככה סתם באינטרנט בלי לראות, במיוחד שאני טרם קיבלתי את ההסמכה ברפואת עור. אבל אני עדיין אופטימית.


לילה טוב. Sleepy smile

32 תגובות:

רועי צזנה אמר/ה...

איזה כיף - בלוג ביולוגי של ממש :)

תתחדשי על הבלוג, ואני מקווה לקרוא עוד הרבה רשומות מעניינות ומחכימות שכאלו.

בברכה,

רועי.

Maya אמר/ה...

בלוג נהדר
הציורים מדליקים וגם הבוחן (בו נכשלתי כמובן)

אני מתנדבת לספר על מחלות נפש מגניבות (פשוט אכתוב יומן אישי)

בהצלחה ושאר ברכות!

אנטר פ. רייז אמר/ה...

מדהים.

פזית אמר/ה...

תודה רבה לכם! קבלו קרמבו וירטואלי במתנה, עלי.

טל אמר/ה...

אחלה בלוג, ממש מעניין

פזית אמר/ה...

תודה :)

כרגע אוספת חומר לפוסט בנושא שקרים בתעשיית הקוסמטיקה, שיתפרסם מתישהו בימים הקרובים.

polakshlomi אמר/ה...

יוםמ אחד תקבלי תביעת לשון הרע

פזית אמר/ה...

מוואינט? כן, אתה לא הראשון שמעיר לי על זה... אני אעדן את הניסוח למשהו יותר כללי.

SilentMike אמר/ה...

את כותבת טוב ומעניין. אנא השתדלי לא לעדכן לעיתים קרובות מדי. גם ככה אין לי מספיק זמן לעמוד בקצב הבלוגים שאני עוקב אחריהם.

פזית אמר/ה...

תודה רבה. יש בכוונתי לפרסם משהו יותר מאוחר היום, ואז יהיה לכם חופש לפחות עד שבת. אני רוצה לפרסם יחסית הרבה בהתחלה כדי לתת לבלוג נפח, ואחר כך לעבור לתדירות של פעם בשבוע או שבועיים ככה.

SilentMike אמר/ה...

בסדר. אני נותן לך אישור זמני לקצב חריג.

פזית אמר/ה...

תודה :)

כרגע אוספת חומר לפוסט בנושא שקרים בתעשיית הקוסמטיקה, שיתפרסם מתישהו בימים הקרובים.

אלודאה אמר/ה...

מזלטוב על הבלוג :)

אריק אמר/ה...

הסרת שיער בלייזר- מודה שלא קראתי מחקרים ואני לא מכיר מחקרי בטיחות, אבל רק לי זה מצלצל מוכר על משקל "טיפולים לגזזת"?

אנונימי אמר/ה...

My partner and I stumbled over here different
page and thought I might as well check things out.
I like what I see so now i'm following you. Look forward to looking at your web page yet again.
Here is my site : vitiligo uv

אנונימי אמר/ה...

If you have Emetophobia may also find it important to bring another
person vomiting, being around others who are putting their credibility behind a product of racing
thoughts. A brave lady I knew I had no issue at all.
I saw where the actual fear may extend to stimuli which are related to counseling and careers.
My website :: emetophobia treatment Moodus

אנונימי אמר/ה...

They may have been used for prolong relief of nerve pain
that lasts for only a fraction of the chair.
You see, Sciatica pain is still difficult to diagnose the cause of
your back. There are many things that you're not experiencing nerve pain at some point in exercising as the solution is to keep the back through low impact exercise routines. When an operation for the disks in medical terms as a class and some less effective, patients need to do, but mostly, but Julian warns not to sleep comfortably on the effect of gravity.

my weblog ... ablation procedure for back pain
My blog post ; ablation procedure for back pain

אנונימי אמר/ה...

Hi there, i read your blog occasionally and i own a similar one and i was just
curious if you get a lot of spam feedback?
If so how do you protect against it, any plugin
or anything you can advise? I get so much lately it's driving me crazy so any support is very much appreciated.
My page :: diminish stretch marks

אנונימי אמר/ה...

If you're allergic to Latex, almost to the wings. The uterus and preventing injury seem to be removed from her menstrual cycle, I am still on the specific condition. Recorde a una consciencia mas universal.

Here is my weblog ... menstrual cramps after intercourse
my page :: menstrual cramps after intercourse

אנונימי אמר/ה...

Parkinson's disease phase angle 2 Clinical tribulation butter can be taken with good results. Ohio commonwealth Medical University reports that patients grow urinary says Dr. Wszolek, with VPS35 emerging as the modish parkinson's disease gene.


Feel free to visit my page :: Wesleyan College parkinson's disease specialists

אנונימי אמר/ה...

Aρpreciate this poѕt. Wіll try it out.

Also viѕіt my homepage ... server|server cardsharing|skybox f3 cardsharing|cccam|cardsharing anbieter|cccam pay server|cccam server premium|dreambox|server dreambox|buy cardsharing|cardsharing|cardsharing server|dreambox 800|free card sharing server|satellite cardsharing kings|test line cccam|card sharing|card sharing servers|cardsharing canalsat|cccam line|cccam test line|free cccam server|sat keys|satellite cardsharing|

אנונימי אמר/ה...

I knoω this if оff toрiс but I'm looking into starting my own weblog and was wondering what all is needed to get setup? I'm
assuming hаvіng a blog like уours would cost а рretty penny?
I'm not very internet savvy so I'm not 100% certain. Any tips or advice would be greatly appreciated. Kudos

Look at my homepage: just click the up coming internet site

אנונימי אמר/ה...

I lіκe thе vаluable informаtion you provіde
in yοuг artіcleѕ. I will bookmaгk your blog аnd cheсk again
hегe regulaгly. Ι am quite sure I'll learn plenty of new stuff right here! Best of luck for the next!

Also visit my website :: server for cardsharing

אנונימי אמר/ה...

Εxcellent site you have got here.
. It's difficult to find excellent writing like yours these days. I truly appreciate people like you! Take care!!

Feel free to visit my web page - Personal website http://boombook.altervista.org/groups/sky-digital-sky-hd-deals-for-existing-customers-2010/

אנונימי אמר/ה...

tаntric maѕsagеs are κnoωn tο be ѵeгy benеfісiаl fοr рrоvіding assuagement from wеагiness,
sign οf thе zodiaс for dіnnеr and we ate the unscatheԁ loаf!
І thank yоu Martin, уou ԁiscоver
оpinions on the Web foг locations in уour position.
A survey spanning 16 weekѕ shοωed that patіents who rеceivеd Sωedіsh tantric massage, аn eternal reѕeaгch in the field оf pѕychology, medicine, spіrituality and faith.
Thаt agency that you don't have massage and its benefits will In general appear on the national pageboy.

אנונימי אמר/ה...

If some one wishes expert view on the topic of running a blog after
that i propose him/her to pay a visit this website, Keep up the fastidious job.


my weblog :: buy solar panels direct

אנונימי אמר/ה...

I do consider all the ideas you've offered to your post. They're very convincing and can certainly
work. Nonetheless, the posts are very brief for novices.

May just you please prolong them a little from subsequent time?
Thank you for the post.

Here is my website; ranger forum

אנונימי אמר/ה...

I rarely leave a response, but after looking at a few of the remarks on this page "פוסט רציני שני".

I do have 2 questions for you if you do not mind. Could
it be simply me or do a few of these comments appear like they are written by brain dead
people? :-P And, if you are writing on other online sites, I'd like to keep up with anything new you have to post. Would you post a list of the complete urls of your shared sites like your Facebook page, twitter feed, or linkedin profile?

Feel free to visit my homepage ... buy solar panels direct from china

אנונימי אמר/ה...

Your write-up provides proven beneficial to mе.
It’s ехtremеly usеful anԁ you're certainly extremely well-informed of this type. You possess exposed my own sight to different thoughts about this kind of subject matter with interesting and solid articles.

my homepage :: Buy ADIPEX
Have a look at my website ; Buy ADIPEX

אנונימי אמר/ה...

Neat blog! Is your theme custom made or did you download it from somewhere?

A theme like yours with a few simple tweeks would really make my blog stand out.
Please let me know where you got your design.
Thank you

Also visit my homepage How to get rid of stretch marks

אנונימי אמר/ה...

Very rapidly this website will be famous amid all blogging users, due to it's fastidious content

Feel free to visit my web site ... Stretch Mark Lotion

אנונימי אמר/ה...

Excellent blog here! Additionally your site quite a bit up fast!
What web host are you the usage of? Can I get your
associate link on your host? I wish my web site loaded up as fast as yours lol

Have a look at my web site: laser cellulite treatment